anti-doping analysis raises a handful of sensible questions. This page answers them in order, starting with the fundamentals and moving to applications.
Reviewed 2026-03-22. Anything still debated is marked as such rather than presented as settled.
Laboratory studies have reported that AOD9604 can increase lipolysis and reduce lipid accumulation in fat cells. The precise molecular target remains uncertain, and the compound does not appear to activate the growth hormone receptor in the same way as full-length hGH. Proposed mechanisms include effects on beta-adrenergic signaling and enzymes involved in fatty acid synthesis, but these pathways are not firmly established. Because most evidence comes from cell and animal models, whether the same effects occur in humans is an open question.
Clinical development of AOD9604 included trials in people with obesity, but the results did not lead to approval as a prescription medicine in major markets. Interest later shifted to research settings and to unapproved products marketed for body composition. Regulatory agencies have questioned whether the peptide qualifies as a dietary ingredient, and some have issued warnings about its presence in supplements. Long-term human safety data are limited, and questions about efficacy, dosing, and target populations remain unresolved.
AOD9604 is a synthetic peptide modeled on the C-terminal region of human growth hormone. It corresponds to a short sequence near the end of the 191-amino-acid hormone, often described as residues 176–191 or a related fragment. Researchers designed it to separate metabolic effects from the growth-promoting actions of full-length growth hormone. Early work in the 1990s explored it as a candidate for weight and lipid disorders. It is not a naturally circulating hormone fragment produced in large amounts.
Research interest in AOD-9604 often focuses on whether it can influence lipid metabolism without the growth-promoting or glucose-related effects of full-length hGH. This question remains unresolved, and findings depend on model, dose, and measurement method. Some reviews treat the peptide as a historical obesity candidate rather than an active therapeutic. Others cite it in discussions of peptide fragments, metabolic signaling, and performance-enhancing substances. Clear conclusions are limited by the small number of rigorous, independent human studies.
AOD-9604 has been investigated primarily as a potential treatment for obesity and related metabolic conditions. Early laboratory work examined its effects on fat cells, and later studies moved into animal models and human clinical trials. Some trials reportedly reached Phase II, but the program did not lead to an approved medicine. Published summaries often note that weight-loss results were modest or inconsistent. The full trial data are not all publicly available in detail.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Synthetic peptide | Derived from C-terminal region of human growth hormone |
| Approximate molecular mass | About 1.8 kDa | Varies with sequence length and counterions |
| Confirmed receptor target | None established | No confirmed growth hormone receptor agonism |
| Reported in vitro activity | Lipolysis stimulation and lipogenesis inhibition | Observed mainly in adipocyte models; human relevance uncertain |
| Regulatory status | Not approved as a drug in major markets | May be treated differently across jurisdictions; not a recognized dietary ingredient in some countries |
AOD-9604 is prohibited in sport by the World Anti-Doping Agency under the peptide hormone class. Its presence in a sample can be detected through mass spectrometry-based methods, although the exact assay depends on the laboratory. In research settings, material is often supplied as a lyophilized powder for reconstitution. Buyers and researchers should note that products labeled AOD-9604 may vary in purity and actual peptide content. Analytical certificates and independent testing are common ways to verify identity, but no global harmonized standard exists for all commercial lots.
AOD-9604 is a synthetic peptide whose sequence is modeled on the C-terminal region of human growth hormone. Published descriptions commonly place it as a modified fragment corresponding to hGH amino acids 176–191, with a tyrosine residue added or retained at the N-terminus to support detection and handling. It is not intact growth hormone and lacks the full receptor-binding architecture of the parent protein. The molecule was developed as a research candidate for metabolic studies rather than as a replacement for growth hormone therapy. Its identity is defined by its amino acid sequence rather than by any single commercial preparation.
Regulatory interest in AOD-9604 increased after high-profile anti-doping cases involving peptide products. In some cases, the substance was supplied under alternative names or in compounded preparations, complicating traceability. Sports tribunals and anti-doping panels have discussed whether the peptide was explicitly banned at the time of use, leading to clarifications by the World Anti-Doping Agency. For consumers and researchers, the legal status can vary by jurisdiction, and products marketed as research chemicals may lack independent quality verification.
AOD-9604 is listed as a prohibited substance in sport by the World Anti-Doping Agency. It falls under the peptide hormones, growth factors, related substances, and mimetics class on the prohibited list. Anti-doping organizations treat its presence in an athlete's sample as an adverse finding unless a therapeutic use exemption applies. The prohibition reflects concerns about performance enhancement in competitive settings and the difficulty of distinguishing exogenous peptide use from endogenous hormone fragments.
Detection of AOD-9604 in biological samples relies on analytical techniques capable of distinguishing a small synthetic peptide from related endogenous sequences. Liquid chromatography coupled with tandem mass spectrometry is commonly used for confirmatory analysis. Sample preparation may involve immunoaffinity enrichment or solid-phase extraction to concentrate the peptide. Because the molecule is small and may be present at low concentrations, assay sensitivity and specificity are ongoing analytical challenges. Laboratories also validate methods against reference materials when available.
Detection and characterization of AOD-9604 in research and anti-doping settings typically rely on mass spectrometry coupled with liquid chromatography. These methods can identify the peptide by its mass and fragmentation pattern. Immunoassays may also be used in some screening contexts, but they can cross-react with related peptides. Because the molecule is small and may be present at low concentrations, sample preparation and method validation are important. Confirmatory analysis usually requires comparison with a certified reference standard.
In laboratory settings, AOD-9604 is commonly supplied as a lyophilized powder and stored cold to limit degradation. Reconstituted solutions are typically kept refrigerated or frozen, depending on the buffer and concentration, and protected from repeated freeze-thaw cycles. Stability can be influenced by pH, temperature, and the presence of proteases. Purity is usually assessed by high-performance liquid chromatography and mass spectrometry. These practices support reproducibility, but they do not imply safety or efficacy for any human use.
Regulatory status: AOD-9604 is not approved as a therapeutic drug in the United States, European Union, or other major markets. It is listed by the World Anti-Doping Agency as a prohibited substance in sport, specifically under growth hormone fragments. Many jurisdictions restrict its sale for human consumption. Products marketed online may not meet pharmaceutical quality standards. The legal status varies by country and often depends on whether the material is presented as a research chemical, supplement, or drug.
AOD9604 is commonly supplied as a white to off-white lyophilized powder. The powder is typically stored at -20 °C or below, protected from light and moisture, because peptides can degrade through oxidation, hydrolysis, or aggregation. If it is reconstituted for laboratory use, an appropriate aqueous buffer or solvent is chosen, and the solution is kept cold and handled to avoid repeated freeze-thaw cycles. These practices support stability but do not imply suitability for human use.
Identity and purity are usually assessed with reversed-phase high-performance liquid chromatography and mass spectrometry. Reversed-phase HPLC separates the peptide from related impurities and can estimate purity by ultraviolet absorbance, while mass spectrometry confirms the molecular mass and detects modifications. Peptide mapping, amino acid analysis, and disulfide mapping may be used when the sequence or disulfide arrangement must be verified. Because AOD9604 contains cysteine residues, oxidation and disulfide isomers are possible quality concerns in synthetic batches.
where the M over the arrow denotes that to conserve energy and momentum a third body is required (the molecularity of the reaction is three). Electron capture can be used in conjunction with chemical ionization.
=== Popular culture === In the 2001 comedy film Evolution selenium was mentioned as an active ingredient of the anti-dandruff shampoo Head & Shoulders. A group of academics, therefore, tried to use this brand of shampoo to stop an alien invasion after discovering that the alien life form was sensitive to selenium.
== Prognosis == Untreated hypersomatotropism has a guarded to poor prognosis. In most cases the insulin resistance and other symptoms get progressively worse causing insulin treatment to become difficult. Euthanasia often occurs a few months after diagnosis in cats due to owner's being unable or unwilling to deal with treatment. Other reasons for euthanasia include congestive heart failure, renal failure, respiratory distress, and neurological symptoms. Cats that have been treated with radiotherapy or pituitary surgery may have a good prognosis; survival has been observed for several years. In progestogen induced hypersomatotropism the prognosis is usually good after cessation of progestogen administration. In dogs soft tissue changes are usually resolved in a few weeks or months, persistent bone changes usually do not cause clinical problems. For diabetes mellitus the prognosis for the condition depends on the beta cell damage.
The GIUK gap (sometimes written G-I-UK) is an area in the northern Atlantic Ocean that forms a naval choke point. Its name is an initialism for Greenland, Iceland, and the United Kingdom, the gap being the two stretches of open ocean among these three landmasses. It separates the Norwegian Sea and the North Sea from the open Atlantic Ocean. The term is typically used in relation to military topics. The area has been considered strategically important since the beginning of the 20th century.
=== GLUT 1 === Every carrier protein, especially within the same cell membrane, is specific to one type or family of molecules. GLUT1 is a named carrier protein found in almost all animal cell membranes that transports glucose across the bilayer. This protein is a uniporter, meaning it transports glucose along its concentration in a singular direction. It is an integral membrane protein carrier with a hydrophilic interior, which allows it to bind to glucose. As GLUT 1 is a type of carrier protein, it will undergo a conformational change to allow glucose to enter the other side of the plasma membrane. GLUT 1 is commonly found in the red blood cell membranes of mammals.
Sources: en.wikipedia.org
The Shrake–Rupley algorithm is a numerical method that draws a mesh of points equidistant from each atom of the molecule and uses the number of these points that are solvent accessible to determine the surface area. The points are drawn at a water molecule's estimated radius beyond the van der Waals radius, which is effectively similar to 'rolling a ball' along the surface. All points are checked against the surface of neighboring atoms to determine whether they are buried or accessible. The number of points accessible is multiplied by the portion of surface area each point represents to calculate the ASA. The choice of the 'probe radius' does have an effect on the observed surface area, as using a smaller probe radius detects more surface details and therefore reports a larger surface. A typical value is 1.4Å, which approximates the radius of a water molecule. Another factor that affects the results is the definition of the VDW radii of the atoms in the molecule under study. For example, the molecule may often lack hydrogen atoms, which are implicit in the structure. The hydrogen atoms may be implicitly included in the atomic radii of the 'heavy' atoms, with a measure called the 'group radii'. In addition, the number of points created on the van der Waals surface of each atom determines another aspect of discretization, where more points provide an increased level of detail.
Pseudoenzymes are variants of enzymes that are catalytically-deficient (usually inactive), meaning that they perform little or no enzyme catalysis. They are believed to be represented in all major enzyme families in the kingdoms of life, where they have important signaling and metabolic functions, many of which are only now coming to light. Pseudoenzymes are becoming increasingly important to analyse, especially as the bioinformatic analysis of genomes reveals their ubiquity. Their important regulatory and sometimes disease-associated functions in metabolic and signalling pathways are also shedding new light on the non-catalytic functions of active enzymes, of moonlighting proteins, the re-purposing of proteins in distinct cellular roles (Protein moonlighting). They are also suggesting new ways to target and interpret cellular signalling mechanisms using small molecules and drugs. The most intensively analyzed, and certainly the best understood pseudoenzymes in terms of cellular signalling functions are probably the pseudokinases, the pseudoproteases and the pseudophosphatases. Recently, the pseudo-deubiquitylases have also begun to gain prominence.
Adoptive immunity acts in a host after their immunological components are withdrawn, their immunological activity is modified extracorporeally, and then reinfused into the same host. This process in its former part is analogous to adoption: a child is once adopted out from their home, grown up, and then returned to their home of birth. Transferred immunological components include immune cells such as T lymphocytes or tumour-infiltrating lymphocytes, NK cells, macrophages, or B cells. There seems to be some variation in usage of this term.
CooA is a homodimeric, heme-containing transcription factor of the CAP/CRP family, with each monomer comprising an N-terminal heme-binding regulatory domain and a C-terminal helix-turn-helix motif that acts as a DNA-binding domain. The N-terminal domain coordinates a b-type heme whose axial ligands differ between species (for example, His-Pro versus His-His), and carbon monoxide (CO) binding to this heme triggers conformational changes that activate DNA binding. The two subunits associate through a coiled-coil-like interface, positioning the paired helix–turn–helix motifs to recognize target palindromic sequences in promoter DNA and thereby regulate genes involved in CO oxidation. Several structures of CooA have been solved, including: RrCooA in the ferrous state (1FT9), ChCooA in the ferrous, imidazole-bound state (2FMY), ChCooA in the ferrous, CO-bound state (2HKX).
They Hunger is a single player horror-based mod of Valve's first-person shooter Half-Life. It was released by Neil Manke's Black Widow Games in three episodes, They Hunger (2000), They Hunger 2: Rest in Pieces (2000), and They Hunger 3: Rude Awakening (2001). All three episodes were sponsored by PC Gamer and appeared on the magazine's cover disk. The original mod received positive reviews from critics; who commended the project's quality, horror elements, and the way it used the GoldSrc engine. A fourth game made for the Source engine, They Hunger: Lost Souls, was cancelled.
Sources: en.wikipedia.org
At room temperature, cannabidiol is a colorless crystalline solid. In strongly basic media and the presence of air, it is oxidized to cannabinodiol (CBND) and a quinone called HU-331. Under acidic conditions it cyclizes to a multitude of products including THC-9 and iso-THC , which also occurs during pyrolysis, and during smoking. The synthesis of cannabidiol has been accomplished by several research groups.
=== Crack tip plastic zone === In theory the stress at the crack tip where the radius is nearly zero, would tend to infinity. This would be considered a stress singularity, which is not possible in real-world applications. For this reason, in numerical studies in the field of fracture mechanics, it is often appropriate to represent cracks as round tipped notches, with a geometry dependent region of stress concentration replacing the crack-tip singularity. In actuality, the stress concentration at the tip of a crack within real materials has been found to have a finite value but larger than the nominal stress applied to the specimen. Nevertheless, there must be some sort of mechanism or property of the material that prevents such a crack from propagating spontaneously. The assumption is, the plastic deformation at the crack tip effectively blunts the crack tip. This deformation depends primarily on the applied stress in the applicable direction (in most cases, this is the y-direction of a regular Cartesian coordinate system), the crack length, and the geometry of the specimen. To estimate how this plastic deformation zone extended from the crack tip, Irwin equated the yield strength of the material to the far-field stresses of the y-direction along the crack (x direction) and solved for the effective radius. From this relationship, and assuming that the crack is loaded to the critical stress intensity factor, Irwin developed the following expression for the idealized radius of the zone of plastic deformation at the crack tip:
==== Denial of cardiovascular health claims ==== In 2001, the U.S. Food and Drug Administration rejected proposed health claims for vitamin E and cardiovascular health. The U.S. National Institutes of Health reviewed literature published up to 2008 and concluded "In general, clinical trials have not provided evidence that routine use of vitamin E supplements prevents cardiovascular disease or reduces its morbidity and mortality." The European Food Safety Authority (EFSA) reviews proposed health claims for the European Union countries. In 2010, the EFSA reviewed and rejected claims that a cause and effect relationship has been established between the dietary intake of vitamin E and maintenance of normal cardiac function or of normal blood circulation.
=== Polyadenylation === Based on software analysis of the mRNA sequences various polyadenylation patterns could be identified for the transcription variants . TV1 and TV2 share the same pattern located on exon 10 starting at position 1246 resulting in a 32 nucleotide motif (AGUAGAGUCUGCGCUGUGACCUUCUGUUGGGC). TV3 uses a motif on exon 11 at the position 320. The motif is also 32 nucleotides long, but differs from the sequence used by TV1/2 (AGUGGCUUGUUCCACCUCAGCUCCCAUCUAAC). The difference in the polyadenylation sequence results in a variance of the minimum free energy values of the predicted RNA folding structures (-28.70 kcal/mol, TV1 and TV2 and -16.03 kcal/mol, TV3), which could result in different length of the Poly-A tail. Based on the observation that stable secondary structures result in decreased polyadenylation of the specific site, this might indicate that TV1 and TV2 are less polyadenylated in comparison to TV3.
=== Target animal safety === In swine, ractopamine is correlated with adverse effects, especially hyperactivity, trembling, and broken limbs, leading to censure by animal rights groups. In a conversation with Boulder Weekly newspaper, Colorado State University Professor of Animal Science Temple Grandin, an expert on animal welfare, described harmful effects of ractopamine on feedlot animals, such as cattle with stiff, sore, and lame limbs, and increased heat stress. In the same column, she also opines that meat from ractopamine-treated animals may be tougher. Ractopamine use is a factor in the incidence of downer pigs, animals that are unable to move or stand.
Sources: en.wikipedia.org
AOD9604 is a synthetic peptide based on a C-terminal segment of human growth hormone. It is manufactured by chemical peptide synthesis rather than extracted from human tissue. The sequence is often described as hGH fragment 176–191 or a close variant.
It is not approved as a prescription drug in the United States or the European Union for any indication. Regulatory status can differ by country, and it is often sold as a research chemical or in unapproved products. Such products are not equivalent to an approved medicine.
In the studies reported so far, AOD9604 does not appear to act through the growth hormone receptor and has not shown the typical IGF-1 increase caused by full-length hGH. Human data are limited, so this remains an area of uncertainty. It should not be assumed to have the same effects as hGH.
No major medicines regulator appears to have approved AOD-9604 for human therapeutic use. It has been studied in clinical trials, but those programs did not result in a marketed drug.